Ann Lab Med.  2012 Nov;32(6):452-454.

Rare Frameshift Mutation Cys475Tyrfs*11 in the BCR/ABL Kinase Domain Contributes to Imatinib Mesylate Resistance in 2 Korean Patients with Chronic Myelogenous Leukemia

• Park SH
• Chi HS
• Kwon MR
• Cho YU
• Jang S
• Park CJ

Abstract

No abstract available.

MeSH Terms

Adult
Antineoplastic Agents/therapeutic use
Asian Continental Ancestry Group/*genetics
Base Sequence
Benzamides/therapeutic use
Drug Resistance, Neoplasm
Female
Frameshift Mutation
Fusion Proteins, bcr-abl/*genetics
Humans
Leukemia, Myelogenous, Chronic, BCR-ABL Positive/diagnosis/drug therapy/*genetics
Male
Piperazines/therapeutic use
Pyrimidines/therapeutic use
Republic of Korea
Sequence Analysis, DNA
Young Adult
Antineoplastic Agents
Benzamides
Fusion Proteins, bcr-abl
Piperazines
Pyrimidines

Figure

• 

  Fig. 1 Direct sequencing results of the BCR/ABL kinase domain in the 2 patients with CML are shown in the order of wild type (upper), case 1 (middle), and case 2 (bottom) (A). Both of our patients showed a heterozygous insertion of 35 bp (ACTTTGATAACCGTGAAGAAAGAACAAGATAGAAG) between the 1,423rd and 1,424th nucleotides (c.1423_1424insACTTTGATAACCGTGAAGAAAGAACAAGA TAGAAG), which resulted in the substitution of the cysteine with tyrosine at the 475th codon and introduced a premature termination codon at the 11th downstream codon (p.Cys475Tyrfs*11). The results are summarized in the following table (B).

Reference

1. Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. BCR-ABL kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inhibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood. 2011. 118:1208–1215.

2. Soverini S, Martinelli G, Amabile M, Poerio A, Bianchini M, Rosti G, et al. Denaturing-HPLC-based assay for detection of ABL mutations in chronic myeloid leukemia patients resistant to Imatinib. Clin Chem. 2004. 50:1205–1213.

3. Bamford S, Dawson E, Forbes S, Clements J, Pettett R, Dogan A, editors. Catalogue of Somatic Mutations in Cancer. last updated on 12 Mar 2012. http://www.sanger.ac.uk/genetics/CGP/cosmic.

4. Strhakova L, Bujalkova MG, Hojsikova I, Lukackova R, Behulova R, Mistrik M, et al. Use of direct sequencing for detection of mutations in the BCR-ABL kinase domain in Slovak patients with chronic myeloid leukemia. Neoplasma. 2011. 58:548–553.